HAMES_DBI.A2

Summary of protein SGLT1 (sodium glucose transport 1): Human SGLT1 (hSGLT1) is a high-affinity/low-capacity glucose transporter, which can also transport galactose. In the transport mechanism, two Na+ ions first bind to the extracellular side of the transporter and induce a conformational change in the glucose binding site. This results in an increased affinity for glucose. A second conformational change in the transporter follows, bringing the Na+ and glucose binding sites to the inner surface of the membrane. Glucose is then released, followed by the Na+ ions. In the process, hSGLT1 is also able to transport water and urea and may be a major pathway for transport of these across the intestinal brush-border membrane. hSGLT1 is encoded by the SLC5A1 gene and expressed mostly in the intestine, but also in the trachea, kidney, heart, brain, testis, and prostate. The WHO/UNICEF oral rehydration solution (ORS) for the treatment of secretory diarrhea contains salt and glucose. The glucose, along with sodium ions, is transported by hSGLT1 and water is either co-transported along with these or follows by osmosis. Mutations in SGLT1 are associated with intestinal glucose galactose malabsorption (GGM). Up-regulation of intestinal SGLT1 may protect against enteric infections. SGLT1 is expressed in colorectal, head and neck, and prostate tumors. Epidermal growth factor receptor (EGFR) functions in cell survival by stabilizing SGLT1, and thereby maintaining intracellular glucose levels. SGLT1 is predicted to have 14 membrane-spanning regions. This subgroup belongs to the solute carrier 5 (SLC5)transporter family.

Locus tag: NG_017045

Size: 76998 bp

Accession number: NG_017045

Version: NG_017045.1

Comment: REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from Z74021.1, Z80998.1, Z83849.1, AL022321.1 and Z83839.1. This sequence is a reference standard in the RefSeqGene project. 

Summary: This gene encodes a member of the sodium-dependent glucose transporter (SGLT) family. The encoded integral membrane protein is the primary mediator of dietary glucose and galactose uptake from the intestinal lumen. Mutations in this gene have been associated with glucose-galactose malabsorption. Multiple transcript variants encoding different isoforms have been found for this gene.

There are no discrepancies between the two sources and their descriptions of the protein. 


There are no species other than Homo sapiens that have a low E-value, high percent identity, and high percentage of query cover. 

Primer pair 1: 

  • Forward primer: GCCAAGTGAGCTGTCAATGG
  • Reverse primer: GCCAAGTGAGCTGTCAATGG
Primer pair 2: 
  • Forward primer: GCCAAGTGAGCTGTCAATGG
  • Reverse primer: GCCAAGTGAGCTGTCAATGG

Comments

  1. Alex,
    I noticed your primers are all identical. The purpose of having distinct forward and reverse primers is to bind to two different locations in the genome in order to amplify the region between.

    ReplyDelete

Post a Comment

Popular posts from this blog

HAMES_DBI.A12

HAMES_DBI.A7